View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3137_low_14 (Length: 213)
Name: NF3137_low_14
Description: NF3137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3137_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 195
Target Start/End: Original strand, 16898792 - 16898974
Alignment:
| Q |
13 |
gagatgaaaggtaatgaaatataagacttagttgtagttaaaaacatggttaagtggattgttttgtactataatataaactaaagtgcatgcaaagtta |
112 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16898792 |
gagatgaaaggtgatgaaatataagacttagttgtagttaaaaacatggttaagtggattgttttgtactataatataaactaaagtgcatgcaatgtta |
16898891 |
T |
 |
| Q |
113 |
ttttaatgttgtttgatgttgaaagagtgttttatttttatgttgtagaactagaagaaacaaagaaagatagatcttaaggt |
195 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16898892 |
ttttaatgttgtttgatgttgaaaaggtattttatttttatgttgtagaactagaagaaacaaagaaagatagatcttaaggt |
16898974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 16901671 - 16901734
Alignment:
| Q |
16 |
atgaaaggtaatgaaatataagacttagttgtagttaaaaacatggttaagtggattgttttgta |
80 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| | | |||||||| ||||| ||||||| ||||| |
|
|
| T |
16901671 |
atgaaaggtgatgaagtataagacttagttgttgatgaaaacatgattaag-ggattgtgttgta |
16901734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University