View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3137_low_4 (Length: 295)
Name: NF3137_low_4
Description: NF3137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3137_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 277
Target Start/End: Original strand, 4615367 - 4615629
Alignment:
| Q |
14 |
agaccactcattattttgtcatatatagtctattggttattatttacccgtgtctgaatccggcaaattttggatatcgtcaaaatatcagcccctccaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4615367 |
agaccactcattattttgtcatatatagtctattggttattatttacccatgtctgaatccggcaaattttggatatcgccaaaatatcagcccctccaa |
4615466 |
T |
 |
| Q |
114 |
gaatttggacacataataaagaacagaannnnnnngtctttcaacaacgactatagattccctccaaagtcacaattacataaaagccaaatttttcaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4615467 |
gaatttggacacataataaagaacagaatttttttgtctttcaacaaggactatagattctctccaaagtcacaattacataaaagccaaattttccaat |
4615566 |
T |
 |
| Q |
214 |
caacaatgatggatgtattttaatactttattatgggccataatttttgggtatatgaggtatc |
277 |
Q |
| |
|
||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4615567 |
caagagtg-tggatgtattttaatactttattatgggccataatttttgggtatatgaggtatc |
4615629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 175 - 207
Target Start/End: Original strand, 4559625 - 4559657
Alignment:
| Q |
175 |
ctccaaagtcacaattacataaaagccaaattt |
207 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
4559625 |
ctccaaagtcacaattgcataaaagccaaattt |
4559657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University