View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3137_low_9 (Length: 235)
Name: NF3137_low_9
Description: NF3137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3137_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 38037462 - 38037680
Alignment:
| Q |
1 |
tttagggcttgacttcgatgtaagcaagatttagatttagtttggcattcactgttttgggtgtttagaacatcaaaaaataagcttatcttctacatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38037462 |
tttagggcttgacttcgatgtaagcaagatttagatttagtttggcattcactgttttgggtgtttagaacatcaaaa--taagcttatcttctacatta |
38037559 |
T |
|
| Q |
101 |
gtgtcagattttcaacaattaatggaattgattttttctcattagggccaattttgcaagagtcgcgtccctcctccttatttgctttcttttttattcg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38037560 |
gtgtcagaatttcaacaattaatggaattgattttttctcattagggccaattttgcaagagtcgcgtccctcctccttatttgctttcttttttattcg |
38037659 |
T |
|
| Q |
201 |
aattaggttttgtgttggaat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38037660 |
aattaggttttgtgttggaat |
38037680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University