View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3138_high_15 (Length: 213)

Name: NF3138_high_15
Description: NF3138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3138_high_15
NF3138_high_15
[»] chr5 (2 HSPs)
chr5 (55-194)||(883115-883254)
chr5 (92-137)||(880561-880606)


Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 883254 - 883115
Alignment:
55 catttacagaacaagggtattgagacttttgagactactaatggcaacatcaaacgagttttcttctatgaccctgatggtaatcaagactaattaatta 154  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
883254 catttacaggacaagggtattgagacttttgagactactaatggcaacatcaaacgagttttcttctatgaccctgatggtaatcaagactaattaatta 883155  T
155 gtaatttttgtactataatttactgaaattatgggatgat 194  Q
    ||||||||||||||||||||||||||||||||||||||||    
883154 gtaatttttgtactataatttactgaaattatgggatgat 883115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 92 - 137
Target Start/End: Complemental strand, 880606 - 880561
Alignment:
92 ctaatggcaacatcaaacgagttttcttctatgaccctgatggtaa 137  Q
    |||||||||| ||||||| ||||||||| | |||||||||||||||    
880606 ctaatggcaaaatcaaacaagttttcttttttgaccctgatggtaa 880561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University