View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3138_high_8 (Length: 253)
Name: NF3138_high_8
Description: NF3138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3138_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 2 - 235
Target Start/End: Complemental strand, 643466 - 643233
Alignment:
| Q |
2 |
gtcgtacatacaactcgaggttctccgtggtcttccatcgtcgcaggatctagctatttctcaactgttatgtgctttttgctttcatcattgtttagat |
101 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
643466 |
gtcgtacatacaactagaggttctccgtggtcctccatcgtcgcaggatctagctatttctcaactgttatgtgctttttcctttcatcattgtttagat |
643367 |
T |
|
| Q |
102 |
tcagagaaaacaggttgtttttagacccttcaaagggtggtctgccgccttgagctcctgacttggttgcggtttgtggctctcttaagtttggttgcta |
201 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
643366 |
tcagagaaaataggttgtttttagacccatcaaagggtggtctgccgccttgaccccctgacttggttgcggtttgtggctctgttaagtttggttgtta |
643267 |
T |
|
| Q |
202 |
atggttctagcagatatgtggttgctgggatata |
235 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
643266 |
atggttctagaagatatgtggttgctgggatata |
643233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University