View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3138_low_12 (Length: 245)
Name: NF3138_low_12
Description: NF3138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3138_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 228
Target Start/End: Original strand, 38469584 - 38469809
Alignment:
| Q |
4 |
catgatgttgcatgaagttaatcaagggaactggaaa-tcgatcaaggttggtagaaggggtcctgaagtctcgcacttaatgtttgcagatgatttatt |
102 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38469584 |
catgatgttgcatgaagttaatcaaaggaactggaaaatcgatcaaggttggtagaaggggtcctgaagtctcgcacttaatgtttgcagatgatttatt |
38469683 |
T |
 |
| Q |
103 |
gttatttagaaaagctacgaagattcaaaagtggtgtgtgactcataacttgtaccaggttagtatgctatctggtcaaaaagttagcaatgagaagacc |
202 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38469684 |
gttatttagagaagctacgaagattcaaatgtggtgtgtgactcataacttgcaccaggttagtatgctatctggtcaaaaagttagtaatgagaagacc |
38469783 |
T |
 |
| Q |
203 |
aatatgttcttttctaagaatgtgtc |
228 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38469784 |
aatatgttcttttctaagaatgtgtc |
38469809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University