View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3138_low_9 (Length: 253)

Name: NF3138_low_9
Description: NF3138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3138_low_9
NF3138_low_9
[»] chr4 (1 HSPs)
chr4 (2-235)||(643233-643466)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 2 - 235
Target Start/End: Complemental strand, 643466 - 643233
Alignment:
2 gtcgtacatacaactcgaggttctccgtggtcttccatcgtcgcaggatctagctatttctcaactgttatgtgctttttgctttcatcattgtttagat 101  Q
    ||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
643466 gtcgtacatacaactagaggttctccgtggtcctccatcgtcgcaggatctagctatttctcaactgttatgtgctttttcctttcatcattgtttagat 643367  T
102 tcagagaaaacaggttgtttttagacccttcaaagggtggtctgccgccttgagctcctgacttggttgcggtttgtggctctcttaagtttggttgcta 201  Q
    |||||||||| ||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||| ||    
643366 tcagagaaaataggttgtttttagacccatcaaagggtggtctgccgccttgaccccctgacttggttgcggtttgtggctctgttaagtttggttgtta 643267  T
202 atggttctagcagatatgtggttgctgggatata 235  Q
    |||||||||| |||||||||||||||||||||||    
643266 atggttctagaagatatgtggttgctgggatata 643233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University