View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3139_low_5 (Length: 239)
Name: NF3139_low_5
Description: NF3139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3139_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 11878285 - 11878183
Alignment:
| Q |
1 |
attatgtaaatgtatataatgtatgaactggtgtgggcaatatgtggggggaagaagacagaatgaggaattattactatgccaatagtgcaagttcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| | |
|
|
| T |
11878285 |
attatgtaaatgtatataatgtatgaactggtgtgggcaatatgtggggggaagaagacagaatgaggagttattactatgccaatagtggaagttcatc |
11878186 |
T |
|
| Q |
101 |
acc |
103 |
Q |
| |
|
||| |
|
|
| T |
11878185 |
acc |
11878183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 11878129 - 11878064
Alignment:
| Q |
156 |
aagccatgtgacttctcaataatgagattaacatgtgagatataatgttgtcaacaatgcccggaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11878129 |
aagccatgtgacttctcaataatgagattaacatgtgagatataatgttgtcaacaatgcccggaa |
11878064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University