View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_high_37 (Length: 315)
Name: NF3140_high_37
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 48 - 297
Target Start/End: Original strand, 249768 - 250021
Alignment:
| Q |
48 |
gatggaatgaacccgtgagtgttccgtgggggaccaaccacaattggtgacccaaaatttgtcaatatataatatattcactacaaacaaagacatgtga |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249768 |
gatggaatgaacccgtgagtgttccgtgggggaccaaccacaattggtgacccaaaatttgtcaatatataatatattcactacaaacaaagacatgtga |
249867 |
T |
 |
| Q |
148 |
agagaaagtatttttggctttggcataatatcggtggcaaagaaggatagaggtgat----tgtgtatccacaaatatacattacacttacagcacatat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249868 |
agagaaagtatttttggctttggcataatatcggtggcaaagaaggatagaggtgattacatgtgtatccacaaatatacattacacttacagcacatat |
249967 |
T |
 |
| Q |
244 |
tttagtgcgttttcaatttcatgtcatatgccatttcccaggtcgggtaatgct |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
249968 |
tttagtgcgttttcaatttcatgtcatatgccatttgccaggtcgggtaatgct |
250021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University