View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3140_high_39 (Length: 300)

Name: NF3140_high_39
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3140_high_39
NF3140_high_39
[»] chr1 (2 HSPs)
chr1 (166-245)||(12149903-12149981)
chr1 (241-281)||(12149793-12149833)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 166 - 245
Target Start/End: Complemental strand, 12149981 - 12149903
Alignment:
166 ttgtgtctattttttctacaaaccataaataaaaaatataattaaattgtagtcaaatttacaacatctcgattgcacta 245  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||    
12149981 ttgtgtctattttttctacaaaccataaataaaaa-tataattaaattgtagtcaaatttataacatctcgattgcacta 12149903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 241 - 281
Target Start/End: Complemental strand, 12149833 - 12149793
Alignment:
241 cactaaattattccactctaatagttaactaattagagatg 281  Q
    |||||||||||||||||||||||||||||||||||||||||    
12149833 cactaaattattccactctaatagttaactaattagagatg 12149793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University