View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_high_52 (Length: 250)
Name: NF3140_high_52
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_high_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 18194760 - 18194997
Alignment:
| Q |
1 |
ttatgattaatccaaggttgagttgagaaattctgatttgacacatacaaaaattatggaggacaagccttgcaccgatgttgccaatccccctgcattc |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
18194760 |
ttatgattaatccaaggttgagccgagaaattctgatttgacacatacaaaaattatggaggacaagccttgcaccgacgttgccaatgcccctgcattc |
18194859 |
T |
|
| Q |
101 |
cgaaagaggatcttcatcacaaggaggtggatgatccacagtttgatgcaggttcggtaatgatcagcatcctttcgtgccacttcccgtgtttttactt |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18194860 |
cgaaagagga-cttcatcacaaggaggtggatgatccacagtttgatgcaggttcggtaatgatcagcatcctttcgtgtcacttcccgtgtttttactt |
18194958 |
T |
|
| Q |
201 |
atgtgctttggatctgccctatataaaatcatcattctt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18194959 |
atgtgctttggatctgccctatataaaatcttcattctt |
18194997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 43 - 216
Target Start/End: Original strand, 18189495 - 18189670
Alignment:
| Q |
43 |
acatacaaaaattatggaggacaagccttgcaccgatgttgccaatccccct-gcattccgaaagaggatcttcatcacaaggaggtggatgatccacag |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | |||||||||| |||| ||||||| |||||| ||||||| |||||||||||||||||||| | |
|
|
| T |
18189495 |
acatacaaaaattatggaggacaagccttgcgtcaacgttgccaatcaccctagcattccaaaagagaatcttcagcacaaggaggtggatgatccgc-c |
18189593 |
T |
|
| Q |
142 |
tttgatgcaggttcggtaatgatcagcatccttt-cgtgccacttcccgtgttttt-acttatgtgctttggatctg |
216 |
Q |
| |
|
||| ||| ||||| |||||| |||||||||||| | ||||||| || ||||||| ||||||||||||| ||||| |
|
|
| T |
18189594 |
cttgttgcgggttctgtaatgctcagcatcctttacatgccactaccgttgtttttctcttatgtgctttgaatctg |
18189670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University