View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_high_57 (Length: 234)
Name: NF3140_high_57
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_high_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 40678768 - 40678565
Alignment:
| Q |
16 |
ctttttaactgctcctttcttagtgtttgcagcaaattttgaagccaaaaatgtagcaccaaaaccatgaccagcattatcctcctccaatcccatagaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40678768 |
ctttttaactgctcctttcttagtgtttgcagcaaattttgaagccaaaaatgtagcaccaaaaccatgactagcattatcctcctccaatcccatagaa |
40678669 |
T |
 |
| Q |
116 |
ctctctcctccaccactctcttcataatcctctagctccatcacattttcataatacaaattctctttctctaacaactccattgccaattgtctcttcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40678668 |
ctctctcctccaccactctcttcataatcctctagctccatcacattttcataatacaaattctctttctctaacaactccattgccaattgtctcttcc |
40678569 |
T |
 |
| Q |
216 |
tatg |
219 |
Q |
| |
|
|||| |
|
|
| T |
40678568 |
tatg |
40678565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 79
Target Start/End: Original strand, 13112029 - 13112079
Alignment:
| Q |
29 |
cctttcttagtgtttgcagcaaattttgaagccaaaaatgtagcaccaaaa |
79 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
13112029 |
cctttctttgtatttgcagcaaatcttgaagccaaaacagtagcaccaaaa |
13112079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University