View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_high_58 (Length: 232)
Name: NF3140_high_58
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_high_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 12032011 - 12031894
Alignment:
| Q |
1 |
ttgtgatatttggtataaagaaaatcatcacgaaaatcgaaaatcaacaaataactaacaaccgatggatattttgtttgttggaatacaagctaggttt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12032011 |
ttgtgatatttggtataaagaaagtcatcacgaaaatcaaaaatcatcagataactaacaactgatggatattttgtttgttggaatacaagctaggttt |
12031912 |
T |
 |
| Q |
101 |
tttctgagagttcgtaag |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12031911 |
tttctgagagttcgtaag |
12031894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University