View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3140_high_62 (Length: 216)

Name: NF3140_high_62
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3140_high_62
NF3140_high_62
[»] chr4 (1 HSPs)
chr4 (1-194)||(3950159-3950349)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 3950159 - 3950349
Alignment:
1 gtactaattgagttttgtgttaattttgatgaaatttttctcttaaatgatttttatttcaaaaataatttgtgggaattatccccattcaccgccatat 100  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||  |    ||||||||||||||||||||| ||||||||    
3950159 gtactaattgagttttgtgttaattttgatgaattttttctcttaaatgatttttattgcaaagttc---tgtgggaattatccccattcatcgccatat 3950255  T
101 ccaaccatggatttggatcctttcagtgtgtgtgtagttttgcagtgacaaaaatgattttgaatcaatttattgtgtaaaattgggtttactt 194  Q
    ||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||    
3950256 ccaaccatgaatttggatcctttcagtgtgtttgtagttttgcagtgacaacaatgattttgaatgaatttattctgtaaaattgggtttactt 3950349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University