View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_23 (Length: 402)
Name: NF3140_low_23
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 18 - 394
Target Start/End: Complemental strand, 56327603 - 56327227
Alignment:
| Q |
18 |
acaacacacccgacgatcatgtcacccgcgacattcgtgaaggagtcgccaaattaggtcacttgcgtttcagagttttggactctgctggtttggaagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56327603 |
acaacacacccgacgatcatgtcacccgcgacattcgtgaaggagtcgccaaattaggtcacttgcgtttcagagttttggactctgctggtttggaagc |
56327504 |
T |
|
| Q |
118 |
tgaagccacttctggttccattctccatagaactgcttctttcactgctaatgtcttgtctacttctcattccttactcttcctcactgatgctagagct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56327503 |
tgaagccacttctggttccattctccatagaactgcttctttcactgctaatgtcttgtctacttctcattccttactcttcctcactgatgctagagct |
56327404 |
T |
|
| Q |
218 |
ggtcttcatcctcttgatcaggaagttggaaaatggttgcgcaaaaatgcacctcaacttaaacctattcttgttatgaataaatctgaatccctctttg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56327403 |
ggtcttcatcctcttgatcaggaagttggaaaatggttgcgcaaaaatgcacctcaacttaaacctattcttgttatgaataaatctgaatccctctttg |
56327304 |
T |
|
| Q |
318 |
atgttgatggctctcttgcttctgctgccaatgaaatgtcccgtttaggttttggagatcctattgctatctctgct |
394 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
56327303 |
atgttgatggctctcttgcttcttctgccaatgaaatgtcccgtttagggtttggagatcctattgctatttctgct |
56327227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University