View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_28 (Length: 361)
Name: NF3140_low_28
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 175 - 342
Target Start/End: Original strand, 43029751 - 43029912
Alignment:
| Q |
175 |
agaatcattctgtatctacatcccaaaatggagaagaccatgattctgtcttttctccacctccttcttctccttctcccagatgcagcaaaagctgcca |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
43029751 |
agaatcattctgtatctacatcccaaaatggagaagaccatgattctgtcttttctccacctccttcttctccttctcccaaatccagcaaaagctgcca |
43029850 |
T |
 |
| Q |
275 |
ttggtataggcattggtgttggtgttggcattggaattggcattggcaatggcaatgatggtcctaac |
342 |
Q |
| |
|
||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43029851 |
ttggtatagcca------ttggtgttggcattggcattggcattggcaatggcaatgatggtcctaac |
43029912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 43029577 - 43029691
Alignment:
| Q |
1 |
attatataaaccaaagagaaagtgacaaatgagaaaacatgacactttttaaaaccaattggccccatcaatccatcactctgtgactatctgtctgtct |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029577 |
attacataaaccaaagagaaagtgacaaatgagaaaacatgacacttttaaaaaccaattggccccatcaatccatcactctgtgactatctgtctgtct |
43029676 |
T |
 |
| Q |
101 |
tccagcaagtgagtg |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43029677 |
tccagcaagtgagtg |
43029691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University