View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_31 (Length: 354)
Name: NF3140_low_31
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 48 - 346
Target Start/End: Complemental strand, 45330464 - 45330166
Alignment:
| Q |
48 |
taaattatcactttcaaaaccctaataaaccacaacccctttcttcctcaatttcccttcaaattccatccacacttgccacgccttccaaattcatatc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45330464 |
taaattatcactttcaaaaccctaataaaccacaacccctttcttcctcaatttcccttcaaattccatccacacttgccacgccttccaaattcatatc |
45330365 |
T |
 |
| Q |
148 |
cttttccttcaaatcttgttagatacggattcaacattttgattcggctttaaaaatcgttcccaattatcactattttcaatttcaataactttgttcg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45330364 |
cttttccttcaaatcttgttagatacggattcaacattttgatttggctttaaaaatcgttcccaattatcactattttcaatttcaataactttgttcg |
45330265 |
T |
 |
| Q |
248 |
tatgatttcacctttatgtaaattttggtaaaatcttaactaccttagcgtgaatcacttcctgcatttgtgatggaggacagtgatgcagttgatgat |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45330264 |
tatgatttcacctttatgtaaattttggtaaaatcttaactaccttagcgtgaatcacttcctgcatttgtgatggaggacagtgatgcagttgatgat |
45330166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University