View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_43 (Length: 300)
Name: NF3140_low_43
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 166 - 245
Target Start/End: Complemental strand, 12149981 - 12149903
Alignment:
| Q |
166 |
ttgtgtctattttttctacaaaccataaataaaaaatataattaaattgtagtcaaatttacaacatctcgattgcacta |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12149981 |
ttgtgtctattttttctacaaaccataaataaaaa-tataattaaattgtagtcaaatttataacatctcgattgcacta |
12149903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 241 - 281
Target Start/End: Complemental strand, 12149833 - 12149793
Alignment:
| Q |
241 |
cactaaattattccactctaatagttaactaattagagatg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12149833 |
cactaaattattccactctaatagttaactaattagagatg |
12149793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University