View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_49 (Length: 266)
Name: NF3140_low_49
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 249664 - 249416
Alignment:
| Q |
1 |
ctcgcacttgtcatgtgtgctgatgttaattactagtttgtaatcccggtttaattcaaaccgatccgaacc-----atttgttattttaatatttggat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
249664 |
ctcgcacttgtcatgtgtgctgatgttaatta---gtttgtaatcccggtttaattcaaaccgatccgaaccgaaccatttgttattttaatatttggat |
249568 |
T |
 |
| Q |
96 |
gtaatgactgactacttttgtctcaaaatcaatccaaattgaaccgtaaatactccaactgtcacacaacaatatatacataatatggtagcagctaatt |
195 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249567 |
gtaatgact----acttttgtctcaaaatcaatccaaattgaaccgcaaatactccaactgtcacacaacaatatatacataatatggtagcagctaatt |
249472 |
T |
 |
| Q |
196 |
ttgtcaaagtgcttgattccaatattccacatggatccaattggtttcttccttct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
249471 |
ttgtcaaagtgcttgattccaatattccacatggatccaattggtttcttccttct |
249416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University