View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_51 (Length: 259)
Name: NF3140_low_51
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 19572360 - 19572120
Alignment:
| Q |
13 |
accttttacttgttccctttgctagatgtttggtggtatatgatctttgagtgttcgatattgttgaatcctaaagtatatctgaatttatctccatttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19572360 |
accttttacttgttccctttgctagatgtttggtggtatatgatctttgagtgttcgatattgttgaatcctaaagtatatctgaatttatctccatttg |
19572261 |
T |
|
| Q |
113 |
taatcttaaagtatctgatatcttggattatccattaggattcgtttttgttacttagctattattagtatctgatatcttcaaattcatggtatgtgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19572260 |
taatcttaaagtatctgatatcttggattatccattaggattcgtttttgtcacttagctattattagtatctaatatcttcaaattcatggtatgtgta |
19572161 |
T |
|
| Q |
213 |
taattagttgcaattaatgatgggctgtttcttcatttcac |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19572160 |
taattagttgcaattaatgatgggctgtttcttcaattcac |
19572120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University