View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_55 (Length: 250)
Name: NF3140_low_55
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 26436748 - 26436975
Alignment:
| Q |
1 |
attaataatattagatttcaaaaatatttgtttggtataactgtgcaagtttatgttttatacttgaccacttttctccttttaaacattgatggccttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26436748 |
attaataatattagatttcaaaaatatttatttggtataactgtgcaagtttatgttttatacttgaccactattctccttttaaacattgatggccttt |
26436847 |
T |
|
| Q |
101 |
gtagcatacacttttgcttgaaggtgaggttggtgtttggtggtattggcatgtgattgtgttcaattatgtcannnnnnnaaattacaatcgatgttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26436848 |
gtagcatacacttttgcttgaaggtgaggttggtgtt---tggtattggcatgtgattgtgttcaattatgtcatttttttaaattacaatcgatgttgt |
26436944 |
T |
|
| Q |
201 |
gttgaagtgtgcgtgttgtgccggtgcttgt |
231 |
Q |
| |
|
|| |||||||| ||||||||||||||||||| |
|
|
| T |
26436945 |
gtcgaagtgtgtgtgttgtgccggtgcttgt |
26436975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 3 - 62
Target Start/End: Original strand, 31633269 - 31633328
Alignment:
| Q |
3 |
taataatattagatttcaaaaatatttgtttggtataactgtgcaagtttatgttttata |
62 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
31633269 |
taataatatgggatttcaaaagtatttgtttggtataactgggcaagtatatgttttata |
31633328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University