View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_57 (Length: 250)
Name: NF3140_low_57
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_57 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 19571726 - 19571963
Alignment:
| Q |
13 |
aatattgcagggtacaaactagaagagtgccactggagtggaataagtttcaaacgcacaaactatattaattcattttatggctaatctcagtcacaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19571726 |
aatattgcagggtacaaactagaagagtgccactggagtggaataagtttcaaaagcacaaactatattaattcattttatggctaatctcagtcacaac |
19571825 |
T |
|
| Q |
113 |
ttaattggaacaggttttactctaatttccaatgggtagaccattttacaaactcttgattttgatcaataaagatccacttacagaggatacagtgtta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19571826 |
ttaattggaacaggttttactctaatttccaatgggtagaccattttacaaactcttgattttgatcaataaagatccacttacagaggatacagtgtta |
19571925 |
T |
|
| Q |
213 |
atgactttattaagcttagttgtgtggctgtctttgct |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19571926 |
atgactttattaagcttagttgtgtggttgtctttgct |
19571963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University