View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_58 (Length: 247)
Name: NF3140_low_58
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_58 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 15570969 - 15570779
Alignment:
| Q |
1 |
ctattatttataccaacatggaatttaattgattacgtcatataattgtacacgtataatttgcatttaatatagtggggttggcattggtggatttatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15570969 |
ctattatttataccaacatggaatttaattggttacgtcatataattgtacacgtataatttgcatttaatatagtggggttggcattggtggatttatt |
15570870 |
T |
|
| Q |
101 |
gtaatagggggcaactcgacaatgcatatattttaatgctttaggtaaaaatattgaaacaacaatggaatgcaaaatgattgttttgcat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15570869 |
gtaatagggggcaactcgacaatgcatatattttaatgctttaggtaaaaatattgaaacaacaatggaatgcaaaatgattgttttgcat |
15570779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University