View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_60 (Length: 242)
Name: NF3140_low_60
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_60 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 25 - 242
Target Start/End: Original strand, 43578368 - 43578585
Alignment:
| Q |
25 |
acaacactttatctcaaacacccacttcccaaaacaacactgaatcaaccactcaccccatcaagctttcaaccaaagccagaagaaaagctgctcaaga |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578368 |
acaacactttatctcaaacacccacttcccaaaacaacactgaatcaaccactcaccccatcaagctttcaaccaaagccagaagaaaagctgctcaaga |
43578467 |
T |
|
| Q |
125 |
atcccccgttggaattttacnnnnnnnnctcaacaactgttctaaaaccagtgatgttctacaagcactaaacctctacgacgaagcgcgaaaagcgcat |
224 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43578468 |
atcccccgttggaattttacaaaaaaaactcaacaactgttctaaaaccagtgatgttctacaagcactaaacctctacgatgaagcgcgaaaagcgcat |
43578567 |
T |
|
| Q |
225 |
gttcccctcaatcttgat |
242 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43578568 |
gttcccctcaatcttgat |
43578585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University