View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_67 (Length: 216)
Name: NF3140_low_67
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 3950159 - 3950349
Alignment:
| Q |
1 |
gtactaattgagttttgtgttaattttgatgaaatttttctcttaaatgatttttatttcaaaaataatttgtgggaattatccccattcaccgccatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| | ||||||||||||||||||||| |||||||| |
|
|
| T |
3950159 |
gtactaattgagttttgtgttaattttgatgaattttttctcttaaatgatttttattgcaaagttc---tgtgggaattatccccattcatcgccatat |
3950255 |
T |
 |
| Q |
101 |
ccaaccatggatttggatcctttcagtgtgtgtgtagttttgcagtgacaaaaatgattttgaatcaatttattgtgtaaaattgggtttactt |
194 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
3950256 |
ccaaccatgaatttggatcctttcagtgtgtttgtagttttgcagtgacaacaatgattttgaatgaatttattctgtaaaattgggtttactt |
3950349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University