View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_70 (Length: 213)
Name: NF3140_low_70
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_70 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 2 - 152
Target Start/End: Complemental strand, 702272 - 702118
Alignment:
| Q |
2 |
actagaacatgatactaccatgttgatagttataattgaaagtacacaattgatatgtaccctacacttatatcagtgtttgtattatttgaataaaata |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
702272 |
actagaacatgatactaccatgttgatagttataattgaaagtacacaattgatatgtaccttacacttatatcagtgtttgtattatttgaataaaata |
702173 |
T |
|
| Q |
102 |
ttatttggtttttggttc----aatatacttttattcgatcatttaagataactg |
152 |
Q |
| |
|
| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
702172 |
tgatttggtttttggttcaattaatatacttttattcgatcatttaagataactg |
702118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University