View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3140_low_71 (Length: 211)
Name: NF3140_low_71
Description: NF3140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3140_low_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 60 - 193
Target Start/End: Complemental strand, 16560045 - 16559911
Alignment:
| Q |
60 |
ttgttcgcagctgaggtgtgagtctagcgcttgcaaagactgtgatagtaagtacgacaatgaagaggg-atgcaattatgttgttctggtgggcagctg |
158 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16560045 |
ttgttcgcagctgaggcgtgagtctagcgcttgcaaagactgtgatagtaagtacgacgatgaagaggggatgcaattatgttgttctggtgggcagctg |
16559946 |
T |
|
| Q |
159 |
gtgtacaagacggagagggagtgtggctttggagt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
16559945 |
gtgtacaagacggagagggagtgtggctttggagt |
16559911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University