View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3141A-Insertion-10 (Length: 383)
Name: NF3141A-Insertion-10
Description: NF3141A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3141A-Insertion-10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 8 - 185
Target Start/End: Original strand, 5654893 - 5655071
Alignment:
| Q |
8 |
cttgattggtaccaaaaatgcagctatggtgcagtagaagttaacaaacctgccaaagagcttgaggtatataaagctattgctttaatttgtttaacac |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5654893 |
cttgataggtaccaaaaatgcagctatggtgcagtagaagttaacaaacctgccaaagagcttgaggtatataaagctattgctttaatttgtttaacac |
5654992 |
T |
 |
| Q |
108 |
acatgattatagcatatggccctattcagataaacaacttcattaagcatttatagcct-agtgcttatcatatactac |
185 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5654993 |
acatgattatagcatttggccctattcaaataaacaacttcattaagcatttatagcctaagtgcttatcatatactac |
5655071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University