View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3142_low_10 (Length: 329)
Name: NF3142_low_10
Description: NF3142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3142_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 84 - 314
Target Start/End: Original strand, 32732598 - 32732828
Alignment:
| Q |
84 |
attgcgatttcaaaatctaaaagctacacagtactactattgtgaacaacaatggcggaagattcttctctcagaaacctcatttgcttcgcaatgaaag |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32732598 |
attgcgatttcaaaatctaaaagctacacagtactactattgtggacaacaatggcggaagattcttctctcagaaacttcatttgcttcgcaatgaaag |
32732697 |
T |
 |
| Q |
184 |
cgtcaatggtgcgttgaaactcctcattgctaagcttatcttgtggatacagattttctttcgaagtttctagaagcttttctgtttccgatcgccggag |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32732698 |
cgtcaatggtgcgttgaaactcctcattgctaagcttatcttgtggatacagattttctttcgaagtttctagaagcttcgctgtttccgatcgccggag |
32732797 |
T |
 |
| Q |
284 |
ctgtttcctttgcttcatcttcccagcttct |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32732798 |
ctgtttcctttgcttcatcttcccagcttct |
32732828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 32732513 - 32732548
Alignment:
| Q |
1 |
atcagatagtaccataccataactcttctagattaa |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32732513 |
atcagatagtaccataccataactcttctagattaa |
32732548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University