View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3142_low_11 (Length: 312)
Name: NF3142_low_11
Description: NF3142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3142_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 9e-27; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 22 - 91
Target Start/End: Complemental strand, 14038771 - 14038702
Alignment:
| Q |
22 |
gtggaatccatcaagtcctagagatttctagttacctatactcaagaacgcatttctagtctctttcaaa |
91 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14038771 |
gtggaatccatcatgtcctagagatttctagttacctatactcaagaacgcttttctagtctctttcaaa |
14038702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 252 - 292
Target Start/End: Complemental strand, 14041513 - 14041473
Alignment:
| Q |
252 |
aatgagtgttttgatcgcctagtaccaaccatttacttttt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14041513 |
aatgagtgttttgatcgcctagtaccaaccatttacttttt |
14041473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 239
Target Start/End: Complemental strand, 14041627 - 14041581
Alignment:
| Q |
193 |
aacaaccattctttgaaaattaccctcgttaggaattcaattattat |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
14041627 |
aacaaccattctttgaagattaccctcgttataaattcaattattat |
14041581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University