View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3142_low_19 (Length: 227)
Name: NF3142_low_19
Description: NF3142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3142_low_19 |
 |  |
|
| [»] chr2 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 4594710 - 4594489
Alignment:
| Q |
6 |
aggtttgagtctagaatctattccagttgatctcccccttgtatctgatattgaccctaatgaccccttaaaggcatttctgtagtaacaggatgatata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4594710 |
aggtttgagtctagaatctattccagttgatctcccccttgtatctgatattgaccctaatgaccccttaaaggcatttctgtagtaacaggatgatata |
4594611 |
T |
 |
| Q |
106 |
gcaatatgt-ggggtaagtgatatattatttttctctttgctttagtatttgatatttcaatttcaagtgtcaatgaaccagattgaagtttgaacggtt |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4594610 |
gcaatatgtgggggtaagtgatatattatttttctctttgctttagtatttgatatttcaatttc-ggtgtcaatgaaccagattgaagtttgaacggtt |
4594512 |
T |
 |
| Q |
205 |
tgtacaatgcttgatgcatttga |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4594511 |
tgtacaatgcttgatgcatttga |
4594489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 6 - 89
Target Start/End: Complemental strand, 4598334 - 4598251
Alignment:
| Q |
6 |
aggtttgagtctagaatctattccagttgatctcccccttgtatctgatattgaccctaatgaccccttaaaggcatttctgta |
89 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||| || ||||||||| ||||||||||| | |||||||||||||| |
|
|
| T |
4598334 |
aggtttgactctagaatctatggcagttgatctcccccttataggtgatattgatcctaatgacccactgaaggcatttctgta |
4598251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 6 - 95
Target Start/End: Complemental strand, 4586299 - 4586206
Alignment:
| Q |
6 |
aggtttgagtctagaatctattccagttgatctcccccttgtatctgatattgaccctaatgacccctta----aaggcatttctgtagtaaca |
95 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| |||||| || |||||||||| || ||||| | ||| |||||||||||||||||||| |
|
|
| T |
4586299 |
aggtgtgagtctagaatctatggcagttgatctaccccttttagctgatattgatccaaatgattcattaattgaaggcatttctgtagtaaca |
4586206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 214
Target Start/End: Complemental strand, 4586058 - 4586015
Alignment:
| Q |
171 |
agtgtcaatgaaccagattgaagtttgaacggtttgtacaatgc |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||| ||||| |
|
|
| T |
4586058 |
agtgtcaatgaaccagattgaagttttaacagtttgtataatgc |
4586015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University