View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3142_low_20 (Length: 222)
Name: NF3142_low_20
Description: NF3142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3142_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 31098143 - 31098334
Alignment:
| Q |
19 |
aactctgcacaaagggagaaaaatcaatcaccgattacttgttgttctcatttaaaagtcttgcggatgaacttgttgttattgattgaacccttttaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098143 |
aactctgcacaaagggagaaaaatcaatcaccgattacttgttgttctcatttagaagtcttgcggatgaacttgttgttattgattgaacccttttaga |
31098242 |
T |
|
| Q |
119 |
tgatgattttacccttcatattctgaatggtctttgcacttaaaatcgcggcacttcagactccattcgcacatgtcaacacccctttgctt |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098243 |
tgatgattttacccttcatattatgaatggtctttgcacttaaaatcgcggcacttcagactccattcgcacatgtcaacacccctttgctt |
31098334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University