View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3142_low_9 (Length: 338)
Name: NF3142_low_9
Description: NF3142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3142_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 9666041 - 9666261
Alignment:
| Q |
1 |
caatcccatttttcaataccaacaacaacaacaaccctccttactcctactttctctacacaccttcccttattctctctcacaacacccccaattatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666041 |
caatcccatttttcaataccaacaacaacaacaaccctccttactcctactttctctacacaccttcccttattctctctcacaacacccccaattatca |
9666140 |
T |
|
| Q |
101 |
accatggggtgctggagagggtgcttttgtcatttcagatgatgggtcggtgagatttggtgttggttgtgattttgaaggtgtttgtgaaaatgggtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666141 |
accatggggtgctggagagggtgcttttgtcatttcagatgatgggtcggtgagatttggtgttggttgtgattttgaaggtgtttgtgaaaatgggtca |
9666240 |
T |
|
| Q |
201 |
gtgagttttggtgttggatgt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9666241 |
gtgagttttggtgttggatgt |
9666261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 285 - 330
Target Start/End: Original strand, 9666241 - 9666286
Alignment:
| Q |
285 |
gtgagttttggtattggatgtaattttcaaggtgtatgtgatgatg |
330 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9666241 |
gtgagttttggtgttggatgtaattttcaaggtgtatgtgatgatg |
9666286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University