View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3143_high_7 (Length: 314)

Name: NF3143_high_7
Description: NF3143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3143_high_7
NF3143_high_7
[»] scaffold1391 (2 HSPs)
scaffold1391 (212-299)||(68-155)
scaffold1391 (175-210)||(1-36)


Alignment Details
Target: scaffold1391 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: scaffold1391
Description:

Target: scaffold1391; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 299
Target Start/End: Original strand, 68 - 155
Alignment:
212 atcacttcaatccaaatttcataacacaaattgtagtccgactatccatcaatccgatcagtgatccaattattggtgttgattttaa 299  Q
    |||||| ||||||||||||||||||||||||   ||| |||||||||| ||||||||| |||||||||||||||||||||||||||||    
68 atcactccaatccaaatttcataacacaaatcacagttcgactatccaccaatccgattagtgatccaattattggtgttgattttaa 155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1391; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 175 - 210
Target Start/End: Original strand, 1 - 36
Alignment:
175 cattggttttcttgcacatgtctgctgtaataattg 210  Q
    ||||||||||| ||||||||||||||||||||||||    
1 cattggttttcctgcacatgtctgctgtaataattg 36  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University