View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3143_low_1 (Length: 742)
Name: NF3143_low_1
Description: NF3143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3143_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 298 - 728
Target Start/End: Complemental strand, 279544 - 279112
Alignment:
| Q |
298 |
atgagtttgtgtctaacttgacgcaataatttccaaaattccaactctcatagagaggatatttcattttcaaatcatatatcaatcaaagtatgtgaaa |
397 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
279544 |
atgagtttgtgtctaacttgacacaataatttccaaaattccaactctcatagagaggatatttcattttcaaatcatatatcaatcaaagtatatgaaa |
279445 |
T |
|
| Q |
398 |
gcgcattatttgttctttgttcgtacttcactttgttattgattcaaagctacatgtattttaacctacttgtgatttgactatttatatagggttgagg |
497 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
279444 |
acgcattatttgttctttgttcgtacttcactctgttgttgattcaaagctacatgtattttaacctacttgtgatttgactatttatatatggtcgagg |
279345 |
T |
|
| Q |
498 |
agacggttatgtagtaattaatggtcggataagaggcagccgttatggaatggtggccataaatgcagtagacgat-gccgttatgagccacatgacatt |
596 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| | ||| ||||||||||||||||||||||| |
|
|
| T |
279344 |
agacggttatgtagtaattaatggtcggataagaggcaaccgttatggaatggtggccataaatgcggtaaatgatggccgttatgagccacatgacatt |
279245 |
T |
|
| Q |
597 |
acgaggcttcattgagatggagataatccaaggtgagaa-ggggattccactcacttgaacctatgtaaaaacgagccctaatttatggcaggctagact |
695 |
Q |
| |
|
|| ||||||||||||||| |||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
279244 |
actaggcttcattgagatagagaggatccaaggtgagaagggggattccactcacttggacctatgtaaaaacgagccttaatttgttgcaggctagact |
279145 |
T |
|
| Q |
696 |
tttgtctagtccaaaacaatttctattacaaga |
728 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
279144 |
tttgcctagtccaaaacaatttctattacaaga |
279112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University