View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3143_low_6 (Length: 335)
Name: NF3143_low_6
Description: NF3143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3143_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 3e-70; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 44221812 - 44221979
Alignment:
| Q |
16 |
atgagacaacaatacatgctcaaagacactccttgttgtgattgcttagttcattgctgttgtgaatcatgtgcattgtgtcaagaatatcgtgagcttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44221812 |
atgagacaacaatacatgctcaaagacactccttgttgtgattgcttagttcattgctgttgtgaatcatgtgcattgtgtcaagaatatcgtgagcttg |
44221911 |
T |
 |
| Q |
116 |
aaaaccgtggatttgacatggaacttggtatgtatatagtactatatattatgctcttcaatattctttggtggacaattca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44221912 |
aaaaccgtggatttgacatggaacttggtatgtat--------------tatgctcttcaatattctttggtggacaattca |
44221979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 257 - 321
Target Start/End: Original strand, 44222039 - 44222103
Alignment:
| Q |
257 |
catagaaattaaatcactttgaattatagtagtattgtattagtcaactttaatctttgaaattt |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44222039 |
catagaaattaaatcactttgaattatagtagtattgtattagtcaactttaatctttgaaattt |
44222103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 55 - 153
Target Start/End: Original strand, 44211733 - 44211831
Alignment:
| Q |
55 |
gattgcttagttcattgctgttgtgaatcatgtgcattgtgtcaagaatatcgtgagcttgaaaaccgtggatttgacatggaacttggtatgtatata |
153 |
Q |
| |
|
|||||||| |||||||||| ||||| | || || |||||||||||||||||||| ||||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
44211733 |
gattgcttgattcattgctgctgtgaggcctgcgccttgtgtcaagaatatcgtgaacttgagaaccgtggatttaacatggtcattggtatgtatata |
44211831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 55 - 150
Target Start/End: Original strand, 6496106 - 6496201
Alignment:
| Q |
55 |
gattgcttagttcattgctgttgtgaatcatgtgcattgtgtcaagaatatcgtgagcttgaaaaccgtggatttgacatggaacttggtatgtat |
150 |
Q |
| |
|
|||||||| |||||||||| || || |||| || ||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
6496106 |
gattgcttgattcattgctgctgcgaggcatgcgccttgtgtcaagaatatcgtgagcttgaaaaccgtggatttaacatggtcattggtatgtat |
6496201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University