View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3143_low_7 (Length: 314)
Name: NF3143_low_7
Description: NF3143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3143_low_7 |
 |  |
|
| [»] scaffold1391 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1391 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: scaffold1391
Description:
Target: scaffold1391; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 299
Target Start/End: Original strand, 68 - 155
Alignment:
| Q |
212 |
atcacttcaatccaaatttcataacacaaattgtagtccgactatccatcaatccgatcagtgatccaattattggtgttgattttaa |
299 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| |||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
68 |
atcactccaatccaaatttcataacacaaatcacagttcgactatccaccaatccgattagtgatccaattattggtgttgattttaa |
155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1391; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 175 - 210
Target Start/End: Original strand, 1 - 36
Alignment:
| Q |
175 |
cattggttttcttgcacatgtctgctgtaataattg |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1 |
cattggttttcctgcacatgtctgctgtaataattg |
36 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University