View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3144R-Insertion-5 (Length: 247)
Name: NF3144R-Insertion-5
Description: NF3144R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3144R-Insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 39999283 - 39999518
Alignment:
| Q |
9 |
aaatgaagtaatgccattgctatttggctatatagaaatatgatactataaaaggatgggatgtccttctagttcagcattcattctcccctttgaatac |
108 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39999283 |
aaatgaagtaatgccattgctatttgactatatggaaatatgatactataaaaggatgggatgtccttctagttcagcattcattctcccctttgaatac |
39999382 |
T |
|
| Q |
109 |
gaacagattttcactagtgccttgcatggttcttttaagtttcgttgtgacttgtcaaggaggcatcctgaggaagaacttctaccagcattcctgccct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39999383 |
gaacagattttcactagtgccttgcatggtacttttaagtttcgttgtgatttgtcaaggaggcatcctggggaagaacttctaccagcattcctgccct |
39999482 |
T |
|
| Q |
209 |
cgggccaatgacattattatggaaaaaaccctacag |
244 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39999483 |
caggccaatgacattattatggaaaaaaccctacag |
39999518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University