View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3144R-Insertion-6 (Length: 226)
Name: NF3144R-Insertion-6
Description: NF3144R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3144R-Insertion-6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 209
Target Start/End: Complemental strand, 36329869 - 36329668
Alignment:
| Q |
9 |
aaaagtgatgtatatattcttgatacattatgagatgacgtagtagacaagccataaccctcttgactagcataatatgaaaaatttaagttcaaatgta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36329869 |
aaaagtgatgtatatattcttgatacattatgagatgacgtagtagacaagccataaccctcttgactagcataatatgaaaaatttaagttcaaatgta |
36329770 |
T |
|
| Q |
109 |
ttttgaga-ttttagcctgtattcaaatttcaagtgtcttttggagtttaaggataaaataagcactaaccacattgttatatttctgtttgcaaagcat |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36329769 |
ttttgagatttttagcctgtattcaaatttcaagtgtcttttggagtttaagaataaaataagcactaaccacattgttatatttctgtttgcaaagcat |
36329670 |
T |
|
| Q |
208 |
tc |
209 |
Q |
| |
|
|| |
|
|
| T |
36329669 |
tc |
36329668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University