View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3144R-Insertion-7 (Length: 213)

Name: NF3144R-Insertion-7
Description: NF3144R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3144R-Insertion-7
NF3144R-Insertion-7
[»] chr5 (9 HSPs)
chr5 (8-213)||(39472132-39472337)
chr5 (8-209)||(39454739-39454940)
chr5 (56-209)||(39475606-39475762)
chr5 (56-209)||(39451100-39451256)
chr5 (56-210)||(39486564-39486718)
chr5 (57-211)||(39464451-39464605)
chr5 (71-209)||(39470688-39470826)
chr5 (56-211)||(39460348-39460503)
chr5 (132-209)||(39458286-39458363)


Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 8 - 213
Target Start/End: Complemental strand, 39472337 - 39472132
Alignment:
8 acatgtcaacaacaaaagcggcaaggactccattttctgatctggtaatgaggttagatacaacttgtttgacgtttggtttctgagcttcgaggagcgc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
39472337 acatgtcaacaacaaaagcggcaaggactccattttctgatctggtaatgaggttagatactacttgtttgacgtttggtttctgagcttcgaggagcgc 39472238  T
108 agtcatagaggaaccttgatctgtgtttggggcaagagaacattctggaaggttgatgatgtggagtgaatcggagataggaagggatttagtgtagaca 207  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39472237 agtcatagagggaccttgatctgtgtttggggcaagagaacattctggaaggttgatgatgtggagtgaatcggagataggaagggatttagtgtagaca 39472138  T
208 tcggtt 213  Q
    ||||||    
39472137 tcggtt 39472132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 8 - 209
Target Start/End: Complemental strand, 39454940 - 39454739
Alignment:
8 acatgtcaacaacaaaagcggcaaggactccattttctgatctggtaatgaggttagatacaacttgtttgacgtttggtttctgagcttcgaggagcgc 107  Q
    ||||||||||||| ||||| || ||||||||| || ||   |  |||||||||||||||||  |||||||||||||||||||||||||||| ||| | ||    
39454940 acatgtcaacaacgaaagctgcgaggactccacttgcttcaccagtaatgaggttagatacggcttgtttgacgtttggtttctgagcttcaaggtgagc 39454841  T
108 agtcatagaggaaccttgatctgtgtttggggcaagagaacattctggaaggttgatgatgtggagtgaatcggagataggaagggatttagtgtagaca 207  Q
     | ||| |||||| || |||  |||||||||| |||||| ||||||||||||||||||||| ||| |||||||||||| ||||| |||||| |||| |||    
39454840 ggacatggaggaaactggattagtgtttgggggaagagagcattctggaaggttgatgatgcggattgaatcggagattggaagagatttactgtataca 39454741  T
208 tc 209  Q
    ||    
39454740 tc 39454739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 56 - 209
Target Start/End: Complemental strand, 39475762 - 39475606
Alignment:
56 tgaggttagatacaacttgtttgacgtttggtttctgagcttcgaggagcgcagtcat---agaggaaccttgatctgtgtttggggcaagagaacattc 152  Q
    ||||||| || ||| ||||||| |||||||||||||||||||||||||| || |||||   |||| ||||| |||| |||||||||| |||||||  |||    
39475762 tgaggttggagacagcttgttttacgtttggtttctgagcttcgaggagagctgtcatggaagagaaacctggatcggtgtttgggggaagagaaacttc 39475663  T
153 tggaaggttgatgatgtggagtgaatcggagataggaagggatttagtgtagacatc 209  Q
    ||||||||||||||||| ||| || || |||||||||||||||||||||| ||||||    
39475662 tggaaggttgatgatgttgagagattctgagataggaagggatttagtgttgacatc 39475606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 56 - 209
Target Start/End: Complemental strand, 39451256 - 39451100
Alignment:
56 tgaggttagatacaacttgtttgacgtttggtttctgagcttcgaggagcgcagtcatagagg---aaccttgatctgtgtttggggcaagagaacattc 152  Q
    |||||||||| ||  |||||||||| ||||||||||||||||||||||| |||| ||| || |   ||||| |||  |||||||| | |||||||  |||    
39451256 tgaggttagaaacggcttgtttgacatttggtttctgagcttcgaggagagcaggcatggaagcgaaacctggattggtgtttggaggaagagaaacttc 39451157  T
153 tggaaggttgatgatgtggagtgaatcggagataggaagggatttagtgtagacatc 209  Q
    ||||||||||||||||| ||| ||||| |||||||||||||||||||||| ||||||    
39451156 tggaaggttgatgatgttgagagaatctgagataggaagggatttagtgttgacatc 39451100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 56 - 210
Target Start/End: Complemental strand, 39486718 - 39486564
Alignment:
56 tgaggttagatacaacttgtttgacgtttggtttctgagcttcgaggagcgcagtcatagaggaaccttgatctgtgtttggggcaagagaacattctgg 155  Q
    ||||||| |||||| |||||||||||||||||||||||||||| ||||| ||  ||||     ||| | | || |||||||||| |||||||||||||||    
39486718 tgaggttggatacagcttgtttgacgtttggtttctgagcttcaaggagagcgttcatgacaaaacgtggttcggtgtttgggggaagagaacattctgg 39486619  T
156 aaggttgatgatgtggagtgaatcggagataggaagggatttagtgtagacatcg 210  Q
    |||||||||||  ||||| |||||||| || ||||||||||| ||||||||||||    
39486618 aaggttgatgacctggagagaatcggaaatgggaagggattttgtgtagacatcg 39486564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 57 - 211
Target Start/End: Original strand, 39464451 - 39464605
Alignment:
57 gaggttagatacaacttgtttgacgtttggtttctgagcttcgaggagcgcagtcatagaggaaccttgatctgtgtttggggcaagagaacattctgga 156  Q
    ||||||||| ||  ||||||||||||||||||| ||||| || ||||| ||  |||||| ||||||| |||| | | || ||| |||||||  |||||||    
39464451 gaggttagagacggcttgtttgacgtttggtttgtgagcatcaaggagagcgttcatagcggaacctggatcagaggtttggggaagagaaacttctgga 39464550  T
157 aggttgatgatgtggagtgaatcggagataggaagggatttagtgtagacatcgg 211  Q
    ||||||||||  |  || ||||| || || |||| ||||||||||||||||||||    
39464551 aggttgatgacattaagagaatcagatatgggaatggatttagtgtagacatcgg 39464605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 71 - 209
Target Start/End: Original strand, 39470688 - 39470826
Alignment:
71 cttgtttgacgtttggtttctgagcttcgaggagcgcagtcatagaggaaccttgatctgtgtttggggcaagagaacattctggaaggttgatgatgtg 170  Q
    ||||||||||||||| ||| |||||||||||||| ||  |||||   |||||| |||| | | |||||  || ||||  |||||||||||||||||  ||    
39470688 cttgtttgacgtttgctttatgagcttcgaggagagcgttcatatccgaacctggatcagaggttgggagaacagaaacttctggaaggttgatgacatg 39470787  T
171 gagtgaatcggagataggaagggatttagtgtagacatc 209  Q
    ||| ||||| ||||| |||| |||||||| |||||||||    
39470788 gagagaatcagagatgggaatggatttagcgtagacatc 39470826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 56 - 211
Target Start/End: Complemental strand, 39460503 - 39460348
Alignment:
56 tgaggttagatacaacttgtttgacgtttggtttctgagcttcgaggagcgcagtcatagaggaaccttgatctgtgtttggggcaagagaacattctgg 155  Q
    |||| ||||||||  ||||||||||||||| |||||||||||||||||  ||  ||||   ||||  | | ||  ||||||||| |||||||  ||||||    
39460503 tgagattagatacggcttgtttgacgtttgatttctgagcttcgaggaaagccatcattctggaagttggttcgatgtttgggggaagagaaacttctgg 39460404  T
156 aaggttgatgatgtggagtgaatcggagataggaagggatttagtgtagacatcgg 211  Q
    |||||||||||||| ||| ||||| ||  | ||||| ||||||||||  |||||||    
39460403 aaggttgatgatgtcgagagaatcagaagtgggaagtgatttagtgttaacatcgg 39460348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 209
Target Start/End: Original strand, 39458286 - 39458363
Alignment:
132 gtttggggcaagagaacattctggaaggttgatgatgtggagtgaatcggagataggaagggatttagtgtagacatc 209  Q
    |||||||| |||||||||||||||||||| ||  ||||  || ||||||  ||| | |||||||||||||||||||||    
39458286 gtttgggggaagagaacattctggaaggtcgacaatgttaagagaatcgtcgatggcaagggatttagtgtagacatc 39458363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University