View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3145_high_19 (Length: 230)

Name: NF3145_high_19
Description: NF3145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3145_high_19
NF3145_high_19
[»] chr5 (1 HSPs)
chr5 (99-230)||(19419670-19419801)


Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 99 - 230
Target Start/End: Complemental strand, 19419801 - 19419670
Alignment:
99 gatgccgccgaaatcctcaccaccgccggtcacgaagccatggcactcaacctcgaactcgcttcccattctctcatcgctcgccgtcaatctcgctccc 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19419801 gatgccgccgaaatcctcaccaccgccggtcacgaagccatggcactcaacctcgaactcgcttcccattctctcatcgctcgccgtcaatctcgctccc 19419702  T
199 taaccatcttcgctcccacgaacttcgctttc 230  Q
    |||||||||||||||| |||||||||||||||    
19419701 taaccatcttcgctccgacgaacttcgctttc 19419670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University