View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3145_high_22 (Length: 210)

Name: NF3145_high_22
Description: NF3145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3145_high_22
NF3145_high_22
[»] chr2 (1 HSPs)
chr2 (20-195)||(40520929-40521104)


Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 40520929 - 40521104
Alignment:
20 aagaagtgacttaccaagaatccaagaatccgctgatagggggagctggacctagcaacggtgtgctcaaaggaggaggaggtggtggatccattaccta 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40520929 aagaagtgacttaccaagaatccaagaatccgctgatagggggagctggacctagcaacggtgtgctcaaaggaggaggaggtggtggatccattaccta 40521028  T
120 cttacaagttacaacggctgcttcttcagttctaccattcaataaatatgtaaatgttgaataacttgctttcaac 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40521029 cttacaagttacaacggctgcttcttcagttctaccattcaataaatatgtaaatgttgaataacttgctttcaac 40521104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University