View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3145_high_9 (Length: 315)
Name: NF3145_high_9
Description: NF3145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3145_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 28030865 - 28030556
Alignment:
| Q |
1 |
aatagataaatttgttacagtgtcatcgtggtccagtcacaaagaagatagtgccatagtagtagttatccataaggctaagagagcaatatatacggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28030865 |
aatagataaatttgttacagtgtcatcgtggtccagtcacaaagaagatagtgccatagtagtagttatccataaagctaagagagcaatatatacggat |
28030766 |
T |
|
| Q |
101 |
gaataggtctctatgctaaacggataattagaaaaataaggaatcctacttttgctgaaatccttaacaaattggattatcataaacgttcagatataac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28030765 |
gaataggtctctatgctaaacggataattagaaaattaaggaatcctacttttgctgaaatccttaacaaattggattatcttaaacgttcagatataac |
28030666 |
T |
|
| Q |
201 |
c----tgagtaactgttcttctctccactctactcgctataacaaattctcttcattctcaaaattgctcaggtggaaccatttaggtcactttctttca |
296 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28030665 |
ctaagtgagtaactgttcttctctccactctactcgc--taacaaattctcttcattctcaaaattgctcaggt-gaaccatttaggtcactttctttca |
28030569 |
T |
|
| Q |
297 |
ttccttcttctct |
309 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28030568 |
ttccttcttctct |
28030556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University