View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3145_low_17 (Length: 287)
Name: NF3145_low_17
Description: NF3145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3145_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 28030886 - 28031162
Alignment:
| Q |
1 |
tacataatcttttttactaaggaannnnnnnaaaggaaaaatatctatcttcttannnnnnnggtttatccttttgtatatgatatacctcaatt----- |
95 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
28030886 |
tacataatcttttttattaaggaatttttttaaaggaaaaatatttatcttcttatttttttggtttatccttttgtatatgatatacctaaattcaacg |
28030985 |
T |
|
| Q |
96 |
---------caaatatatctaaatctttggtaaacaaataaccatacatacaccattgaatatgttccgatgatttttgaacggacggacactcttttta |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030986 |
tcggtaattcaaatatatctaaatctttggtaaacaaataaccatacatacaccattgaatatgttccgatgatttttgaacggacggacactcttttta |
28031085 |
T |
|
| Q |
187 |
atggttaggtcaatgcccaactcatccggttccttgttcttaatcatactcatcaccttgagacggttgtctggcaa |
263 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28031086 |
atggttaggtcaatgcccaactcatcgggttccttgtccttaatcatactcatcaccttgagacagttgtctggcaa |
28031162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University