View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3145_low_21 (Length: 253)
Name: NF3145_low_21
Description: NF3145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3145_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 2 - 244
Target Start/End: Complemental strand, 7426278 - 7426027
Alignment:
| Q |
2 |
tctaacttcattgaaagtaattctattgaaatcatcgtaggactcaaaaatgaagattt---aatcctttcaactctactagtacattccttcnnnnnnn |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7426278 |
tctaacttcattgaaagtaattctattgaaatcatcgtaggactcaaaaatgaagattttttaatcctttcaactctactagtacattccttcaaaaaaa |
7426179 |
T |
|
| Q |
99 |
---ctctactatgtcccctatcatatttcaccagtagatagtagatacttctaatcgtcaatcgtggtaatgtgtgatttagtgat---tcttactcaca |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
7426178 |
aaactctactatgtcccctatcatatttcaccagtagatagtagatacttctaatcgtcactcgcggtaatgtgtgatttagtgattcttcttactcaca |
7426079 |
T |
|
| Q |
193 |
gttttattccattattcttgaaaagttagaaacaaattaattgatgatgatg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
7426078 |
gttttattccattattcttgaaaagttaaaaacaaataaattgataatgatg |
7426027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University