View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3145_low_27 (Length: 228)
Name: NF3145_low_27
Description: NF3145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3145_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 71 - 210
Target Start/End: Complemental strand, 9801667 - 9801529
Alignment:
| Q |
71 |
gtaaaagagaaaacacttaaatgatgtgactaaatttatctcatttacatgtatgtacctaagtatttttcatttgtaattgtgtttaaataaaacttgc |
170 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9801667 |
gtaaaagagaaaacact-aaatgatgtgactaaatttatctcatttacatgcatgtacctaagtatttttcatttgtaattgtgtttaaataaaacttgc |
9801569 |
T |
|
| Q |
171 |
gtaattcggtttctaagaagattattatggaaggaaaaac |
210 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9801568 |
gtaattcggtttctaagaagattattagggaaggaaaaac |
9801529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 80 - 117
Target Start/End: Complemental strand, 9806679 - 9806642
Alignment:
| Q |
80 |
aaaacacttaaatgatgtgactaaatttatctcattta |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9806679 |
aaaacacttaaataatgtgactaaatttatctcattta |
9806642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University