View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3145_low_28 (Length: 227)
Name: NF3145_low_28
Description: NF3145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3145_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32027792 - 32028011
Alignment:
| Q |
1 |
caaaaattaagaaacaaaccaaccatggtacaatcttttaacccctcaacaactttccttggtgcatgtgatcttcaaaaaatattcctcattggtcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32027792 |
caaaaattaagaaacaaaccaaccatggtacaatcttttaacccctcaacaactttccttggtgcatgtgatcttcaaaaaatattcctcattggtcatc |
32027891 |
T |
 |
| Q |
101 |
cttgatgaatcttgaaggacacatattccttgagacaaaacctcannnnnnnnaatcatcctaatataaacgataaatctaatatcgacgatcaatgtta |
200 |
Q |
| |
|
||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32027892 |
cttaacgaatcttgaaggacacatattccttgagacaaaacctca-tttttttaatcatcctaatataaacgataaatctaatatcgacgatcaatgtta |
32027990 |
T |
 |
| Q |
201 |
aagtacaatttatgtcatata |
221 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
32027991 |
aagtacaatttatgttatata |
32028011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University