View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3145_low_29 (Length: 214)

Name: NF3145_low_29
Description: NF3145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3145_low_29
NF3145_low_29
[»] chr7 (1 HSPs)
chr7 (14-136)||(18516899-18517021)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 14 - 136
Target Start/End: Original strand, 18516899 - 18517021
Alignment:
14 atgaacaagaagaaataaaagcgccaatgccacaccccggttttgccatataccaattatacccctgcctatgtggcaaactactttctcattccaaatt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18516899 atgaacaagaagaaataaaagcgccaatgccacaccccggttttgccatataccaattatacccctgcctatgtggcaaactactttctcattccaaatt 18516998  T
114 atacgtggttttgaaaagaaaaa 136  Q
    |||||||||||||||||||||||    
18516999 atacgtggttttgaaaagaaaaa 18517021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University