View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3145_low_30 (Length: 210)
Name: NF3145_low_30
Description: NF3145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3145_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 40520929 - 40521104
Alignment:
| Q |
20 |
aagaagtgacttaccaagaatccaagaatccgctgatagggggagctggacctagcaacggtgtgctcaaaggaggaggaggtggtggatccattaccta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40520929 |
aagaagtgacttaccaagaatccaagaatccgctgatagggggagctggacctagcaacggtgtgctcaaaggaggaggaggtggtggatccattaccta |
40521028 |
T |
 |
| Q |
120 |
cttacaagttacaacggctgcttcttcagttctaccattcaataaatatgtaaatgttgaataacttgctttcaac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40521029 |
cttacaagttacaacggctgcttcttcagttctaccattcaataaatatgtaaatgttgaataacttgctttcaac |
40521104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University