View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3146_high_20 (Length: 237)
Name: NF3146_high_20
Description: NF3146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3146_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 21 - 221
Target Start/End: Original strand, 133512 - 133712
Alignment:
| Q |
21 |
cttagttttcaccaacattttagaaatagcaatcaaatttaaaaggtaaggaattttctctatatcgcttataatttcaatatttatttcattgttgaag |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
133512 |
cttagttttcaccaacattttagaaatagcaatcaaatttaaaaggtaaggaattttgtctttatcgcttataatttcaatatttatttcattgttgaag |
133611 |
T |
 |
| Q |
121 |
tggtggttgtggtccctattaagcatataaactttaaatgtatgaatgaagggacaatagagaaagataatgttaatttgtggctcaagtttattgccac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
133612 |
tggtggttgtggtccctattaagcatataaactttaaatgtatgaatgaagggacaatagagaaagataatgttaatttgtggctcaagtttattgccac |
133711 |
T |
 |
| Q |
221 |
a |
221 |
Q |
| |
|
| |
|
|
| T |
133712 |
a |
133712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University